Stem-loop sequence vvi-MIR169r

AccessionMI0006532 (change log)
DescriptionVitis vinifera miR169r stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169r
(17 sentences)

Stem-loop 
   --     g             gau         -a       uu  a      aug 
5'   agggu gaauugagucaag   gacuugccg  uauauau  gc gaaggc   c
     ||||| |||||||||||||   |||||||||  |||||||  || ||||||    
3'   ucccg uuugacucaguuc   uugaacggc  augugua  cg uuuucg   a
   uc     g             -ag         ca       -u  a      ggg
Get sequence
Deep sequencing
1486 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16415131-16415239 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169r
vvi-MIR169uchr11: 16409401-16409510 [+]
vvi-MIR169rchr11: 16415131-16415239 [+]
Database links

Mature sequence vvi-miR169r

Accession MIMAT0005687
Sequence

11 -  

ugagucaaggaugacuugccg

 - 31

Get sequence
Deep sequencing1361 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).