Stem-loop sequence vvi-MIR169p

AccessionMI0006531 (change log)
DescriptionVitis vinifera miR169p stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169p
(15 sentences)

Stem-loop 
   --  u       u     aa     a        cagcugcagcaaggcau 
5'   ag guggaau gagcc  ggaug cuugccgg                 u
     || ||||||| |||||  ||||| ||||||||                 a
3'   uc cacuuug cucgg  ccuac gaacgguc                 a
   uc  c       u     ag     -        aauaucggucaauuugg
Get sequence
Deep sequencing
7850 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16347810-16347911 [+]
intergenic
Database links

Mature sequence vvi-miR169p

Accession MIMAT0005686
Sequence

12 -  

gagccaaggaugacuugccgg

 - 32

Get sequence
Deep sequencing5650 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).