Stem-loop sequence vvi-MIR169m

AccessionMI0006530 (change log)
DescriptionVitis vinifera miR169m stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169m
(16 sentences)

Stem-loop
   --  a      gu     aa     a        cagcugcagcaaggcau 
5'   ag guggaa  gagcc  ggaug cuugccgg                 u
     || ||||||  |||||  ||||| ||||||||                 a
3'   uc cacuuu  cucgg  ccuac gaacgguc                 a
   uc  c      gu     ag     -        aauaccggucaauuugg 
Get sequence
Deep sequencing
7580 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16361236-16361337 [+]
intergenic
Database links

Mature sequence vvi-miR169m

Accession MIMAT0005685
Sequence

12 - 

gagccaaggaugacuugccgg

 - 32

Get sequence
Deep sequencing5370 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).