Stem-loop sequence vvi-MIR169j

AccessionMI0006528 (change log)
DescriptionVitis vinifera miR169j stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169j
(15 sentences)

Stem-loop 
   --          u c         ug         aauu   auauaga   -   u     aau 
5'   gagaguggag g agccaagga  acuugccgg    cac       gug gaa gaggc   a
     |||||||||| | |||||||||  |||||||||    |||       ||| ||| |||||   g
3'   cucucgcuuu c ucgguuccu  uggacgguc    gug       uac cuu cuccg   a
   uu          c a         gu         -ccu   ------g   u   -     gcc
Get sequence
Deep sequencing
5583 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr11: 16101917-16102038 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR169j
vvi-MIR169jchr11: 16101917-16102038 [+]
vvi-MIR169dchr11: 16106486-16106605 [+]
vvi-MIR169kchr11: 16108539-16108660 [+]
Database links

Mature sequence vvi-miR169j

Accession MIMAT0005683
Sequence

13 -  

cagccaaggaugacuugccgg

 - 33

Get sequence
Deep sequencing5500 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).