Stem-loop sequence vvi-MIR169c

AccessionMI0006523 (change log)
DescriptionVitis vinifera miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

8 open access papers mention vvi-MIR169c
(15 sentences)

Stem-loop 
   --      ag    c         ug          --       c 
5'   gggagu  aaug agccaagga  acuugccgga  gaugggg a
     ||||||  |||| |||||||||  ||||||||||  |||||||  
3'   cucucg  uuac ucgguuccu  ugaacggccu  uugcucc u
   uu      gg    a         gu          aa       u
Get sequence
Deep sequencing
5747 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr4: 2265925-2266014 [-]
intergenic
Database links

Mature sequence vvi-miR169c

Accession MIMAT0005678
Sequence

13 -  

cagccaaggaugacuugccgg

 - 33

Get sequence
Deep sequencing5499 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).