Stem-loop sequence vvi-MIR168

AccessionMI0006520 (change log)
DescriptionVitis vinifera miR168 stem-loop
Gene family MIPF0000081; MIR168
Literature search

5 open access papers mention vvi-MIR168
(35 sentences)

Stem-loop 
   --g     ua     c          u     a c  c     cgcuccggcagcgccggaggcac 
5'    gucuc  auucg uuggugcagg cggga c ga uucgc                       g
      |||||  ||||| |||||||||| ||||| | || |||||                        
3'    cagag  uaagu aacuacguuc gcccu g cu aagcg                       c
   cgg     gc     c          c     a c  u     agucguugguuagcauccggcgg
Get sequence
Deep sequencing
230444 reads, 1.52e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr2: 17944801-17944932 [-]
intergenic
Database links

Mature sequence vvi-miR168

Accession MIMAT0005675
Sequence

11 -  

ucgcuuggugcaggucgggaa

 - 31

Get sequence
Deep sequencing228819 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).