Stem-loop sequence vvi-MIR167c

AccessionMI0006517 (change log)
DescriptionVitis vinifera miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

7 open access papers mention vvi-MIR167c
(12 sentences)

Stem-loop 
   --  g      u   a       g        caa   c   auac 
5'   ca uagcag uga gcugcca caugaucu   cuu ccu    a
     || |||||| ||| ||||||| ||||||||   ||| |||     
3'   gu guuguc acu cgauggu guacuaga   gaa gga    a
   gg  a      c   c       -        cua   a   acug
Get sequence
Deep sequencing
984588 reads, 6.54e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
NW_003724203.1: 260014-260104 [+]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR167c
vvi-MIR167dNW_003724203.1: 254821-254935 [+]
vvi-MIR167cNW_003724203.1: 260014-260104 [+]
Database links

Mature sequence vvi-miR167c

Accession MIMAT0005672
Sequence

11 -  

ugaagcugccagcaugaucuc

 - 31

Get sequence
Deep sequencing984588 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).