Stem-loop sequence vvi-MIR166h

AccessionMI0006514 (change log)
DescriptionVitis vinifera miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

8 open access papers mention vvi-MIR166h
(17 sentences)

Stem-loop 
   --aac     a      c cu             c  cucgcuucaagua 
5'      aguug ggggaa g  gucugguucgaga ca             c
        ||||| |||||| |  ||||||||||||| ||              
3'      ucaac ccccuu c  cggaccaggcucu gu             a
   acaac     c      a uu             a  aagucuaauacag
Get sequence
Deep sequencing
2425822 reads, 1.62e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr5: 6741188-6741287 [-]
intergenic
Database links

Mature sequence vvi-miR166h

Accession MIMAT0005669
Sequence

69 -  

ucggaccaggcuucauucccc

 - 89

Get sequence
Deep sequencing2425810 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).