Stem-loop sequence vvi-MIR166f

AccessionMI0006512 (change log)
DescriptionVitis vinifera miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

8 open access papers mention vvi-MIR166f
(15 sentences)

Stem-loop 
   ---   a    u        uu g    cu         c     ug  uu 
5'    ugu guug ggggaaug  g cugg  cgaggcuuu uugag  au  u
      ||| |||| ||||||||  | ||||  ||||||||| |||||  ||  a
3'    aca caac ccccuuac  c gacc  gcuucgaaa aacuc  ua  u
   uuc   -    u        uu g    ag         -     ca  ug
Get sequence
Deep sequencing
2315369 reads, 1.54e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr7: 19450014-19450113 [+]
intergenic
Database links

Mature sequence vvi-miR166f

Accession MIMAT0005667
Sequence

69 -  

ucggaccaggcuucauucccc

 - 89

Get sequence
Deep sequencing2310796 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).