Stem-loop sequence vvi-MIR164d

AccessionMI0006506 (change log)
DescriptionVitis vinifera miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

4 open access papers mention vvi-MIR164d
(14 sentences)

Stem-loop 
   --a     u  a        ca            uu  caaauucuaauc  cu    a 
5'    agcuc ug uggagaag  gggcacgugcag  ca            ug  cugc c
      ||||| || ||||||||  ||||||||||||  ||            ||  ||||  
3'    uuggg ac accucuuc  cucgugcacguc  gu            ac  gacg g
   ucc     u  a        cc            uc  cuaaucuuaaac  uu    u
Get sequence
Deep sequencing
102875 reads, 6.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr14: 1414565-1414682 [-]
intergenic
Database links

Mature sequence vvi-miR164d

Accession MIMAT0005661
Sequence

11 -  

uggagaagcagggcacgugca

 - 31

Get sequence
Deep sequencing102868 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).