Stem-loop sequence vvi-MIR159b

AccessionMI0006494 (change log)
DescriptionVitis vinifera miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

4 open access papers mention vvi-MIR159b
(8 sentences)

Stem-loop 
   ----------gggcuugugggagcuucuuuacacuccagaac      g       a  g u        a          cugcauucucuauac 
5'                                           ugaaag agauacu cu c gguucaug aaaccuaugg               u
                                             |||||| ||||||| || | |||||||| ||||||||||               g
3'                                           auuuuc uuuguga ga g ucaaguac uuuggguauc               a
   cuagccaauacucucgagggaagugagguuccggucuuuucu      g       a  g u        g          aaacauauguuuuaa
Get sequence
Deep sequencing
347 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr15: 18471875-18472059 [-]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR159b
vvi-MIR159bchr15: 18471875-18472059 [-]
vvi-MIR159achr15: 18469173-18469366 [-]
Database links

Mature sequence vvi-miR159b

Accession MIMAT0005649
Sequence

155 -  

cuuggagugaagggagcucuc

 - 175

Get sequence
Deep sequencing347 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).