Stem-loop sequence vvi-MIR159a

AccessionMI0006493 (change log)
DescriptionVitis vinifera miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

7 open access papers mention vvi-MIR159a
(14 sentences)

Stem-loop 
   ---     u              a        uu  ga     gaugau    u    ag  g -u   u    ag         -c      au    au 
5'    ggguu augggagcuccuuu cgcuccag  cu  aagga      ggua ccac  cu c  ggu caug  uaccuaugg  ugcaca  auau  a
      ||||| |||||||||||||| ||||||||  ||  |||||      |||| ||||  || |  ||| ||||  |||||||||  ||||||  ||||   
3'    cccaa uacucucgagggaa gugagguu  gg  uuucu      ccgu ggug  ga g  cca guac  guggguauc  acgugu  ugua  g
   cuu     -              -        cc  uc     --aguu    u    aa  g cu   -    gu         aa      gu    ac
Get sequence
Deep sequencing
406 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr15: 18469173-18469366 [-]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR159a
vvi-MIR159bchr15: 18471875-18472059 [-]
vvi-MIR159achr15: 18469173-18469366 [-]
Database links

Mature sequence vvi-miR159a

Accession MIMAT0005648
Sequence

164 -  

cuuggagugaagggagcucuc

 - 184

Get sequence
Deep sequencing347 reads, 2 experiments
Evidence experimental; Array [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).