![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1245a |
||||||
Accession | MI0006380 (change log) | |||||
Previous IDs | hsa-mir-1245 | |||||
Symbol | HGNC:MIR1245A | |||||
Description | Homo sapiens miR-1245a stem-loop | |||||
Gene family | MIPF0000620; mir-1245 | |||||
Literature search |
![]()
4 open access papers mention hsa-mir-1245a | |||||
Stem-loop |
a a uc --u u 5' uuuaugu uaggccuuuagauca uga gu g ||||||| ||||||||||||||| ||| || a 3' aaauaua auccggaaaucuagu auu ca a - c ga ucu u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-1245a |
|
Accession | MIMAT0005897 |
Previous IDs | hsa-miR-1245 |
Sequence |
45 - aagugaucuaaaggccuacau - 65 |
Deep sequencing | 127 reads, 52 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18285502
"Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells"
Genome Res. 18:610-621(2008).
|