miRBase entry: hsa-mir-1305

Stem-loop hsa-mir-1305


Accession
MI0006372
Symbol
HGNC: MIR1305
Description
Homo sapiens hsa-mir-1305 precursor miRNA
Gene family
MIPF0000965; mir-1305

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1305 is a microRNA that has been implicated in various biological processes and diseases. In a study, it was found that overexpression of circCOG2, a circular RNA, led to pro-EMT (epithelial-mesenchymal transition) and activation of TGF-β2. However, this effect was rescued by miR-1305 overexpression, which resulted in the upregulation of E-cadherin and downregulation of vimentin, TGF-β2, SMAD3, and p-SMAD3 [PMC8505430]. In ovarian cancer patients with a shallow deletion of MIR1305 and high DIRAS3 expression (a tumor suppressor gene), better overall survival was observed compared to patients with no alteration in MIR1305 copy number variation [PMC9101105]. MIR1305 has also been implicated in the regulation of osteogenic differentiation [PMC8503254]. Furthermore, it was found that MIR1305 expression is induced by atRA exposure [PMC4168020]. However, there is currently no report linking MIR1305 to RIF (recurrent implantation failure) or its association with upstream circRNA [PMC7924221]. Additionally, the inhibition of NUCKS1 affects changes in the expression of several microRNAs including miR4796, MIR1305, miR4762, and miR4445 [PMC5830027]. These findings highlight the diverse roles and potential clinical relevance of MIR1305 in various biological processes and diseases.

Literature search
7 open access papers mention hsa-mir-1305
(63 sentences)

Sequence

356 reads, 32 reads per million, 40 experiments
aagauccugcuguuucuaccauuaguuuugaauguuuauuguaaagauacUUUUCAACUCUAAUGGGAGAGAcagcaggauucucc
..(((((((((((((((.(((((((..(((((....((((.....))))...)))))..))))))).)))))))))))))))....

Structure
--aa               a       uu     uguu    g 
    gauccugcuguuucu ccauuag  uugaa    uauu u
    ||||||||||||||| |||||||  |||||    |||| a
    uuaggacgacAGAGA GGUAAUC  AACUU    auag a
ccuc               G       UC     -UUc    a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 182169293-182169378 [+]

Disease association
hsa-mir-1305 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1305

Accession MIMAT0005893
Description Homo sapiens hsa-miR-1305 mature miRNA
Sequence 51 - UUUUCAACUCUAAUGGGAGAGA - 72
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621