Stem-loop sequence mmu-mir-1194

AccessionMI0006299 (change log)
Symbol MGI:Mir1194
DescriptionMus musculus miR-1194 stem-loop
Literature search

2 open access papers mention mmu-mir-1194
(3 sentences)

Stem-loop
   acaccuucugcuggagacaauauaaggacau      --a     g      uc      c  ug c   u 
5'                                uggaag   aggga ucuagc  uugcuc uu  c ugc u
                                  ||||||   ||||| ||||||  |||||| ||  | ||| g
3'                                accuuc   uuccu agaucg  aaugag aa  g gcg c
   ---------------------gucgacacuu      agg     -      uc      u  ga u   u 
Get sequence
Deep sequencing
10417 reads, 156 reads per million, 110 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mmu-miR-1194

Accession MIMAT0005852
Sequence

80 - 

gaaugaguaacugcuagauccu

 - 101

Get sequence
Deep sequencing5985 reads, 78 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).