Stem-loop sequence ppt-MIR477b

AccessionMI0006202 (change log)
DescriptionPhyscomitrella patens miR477b stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477b
(11 sentences)

Stem-loop
   ------au    ugga    ggga     g  c   a         u  a       c     -------  u            gu ucu  a 
5'         gugu    acuu    agcag ug uug uccucuccc ca aggcuuc aacag       ca gagcuaguuuua  g   ca a
           ||||    ||||    ||||| || ||| ||||||||| || ||||||| |||||       || ||||||||||||  |   || u
3'         cacg    ugag    ucguc ac aac aggagaggg gu uccgaag uuguc       gu cucgaucggagu  u   gu a
   cuagucuc    ---g    ----     g  u   g         u  c       a     uagacuu  c            ug -cu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 14870936-14871105 [-]
intergenic
Database links

Mature sequence ppt-miR477b

Accession MIMAT0005375
Sequence

34 - 

cucucccucaaaggcuucca

 - 53

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).