Stem-loop sequence rno-mir-488

AccessionMI0006168 (change log)
DescriptionRattus norvegicus miR-488 stem-loop
Gene family MIPF0000318; mir-488
Literature search

5 open access papers mention rno-mir-488
(13 sentences)

Stem-loop 
   --aa  c   cu  c   u      a  c        -  u 
5'     uc ucu  cc aga aauggc cu ucaaacaa gu u
       || |||  || ||| |||||| || |||||||| ||  
3'     ag aga  gg ucu uugucg ga aguuuguu ca c
   ucuc  a   cu  u   -      -  a        a  u
Get sequence
Deep sequencing
104452 reads, 76.1 reads per million, 461 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The predominant miRNA cloned by Landgraf et al. has a 3' additional U residue, which is incompatible with the genome sequence [1].

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr13: 76198593-76198671 [+]
sense
ENSRNOT00000007660 ; Astn1-201; intron 6
Database links

Mature sequence rno-miR-488-5p

Accession MIMAT0017320
Previous IDsrno-miR-488*
Sequence

11 -  

cccagauaauggcacucucaa

 - 31

Get sequence
Deep sequencing546 reads, 98 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-488-3p

Accession MIMAT0005341
Previous IDsrno-miR-488
Sequence

49 -  

uugaaaggcuguuucuugguc

 - 69

Get sequence
Deep sequencing103906 reads, 461 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).