![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-708 |
|||||
Accession | MI0006160 (change log) | ||||
Description | Rattus norvegicus miR-708 stem-loop | ||||
Gene family | MIPF0000397; mir-708 | ||||
Literature search |
![]()
15 open access papers mention rno-mir-708 | ||||
Stem-loop |
-ga a a c g gg a a 5' cugcccuc aggagcuuaca ucuag ug g uag ug c |||||||| ||||||||||| ||||| || | ||| || u 3' gacgggag ucuucgagugu agauc ac c guu ac u ggg a c a a aa c g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-708-5p |
|
Accession | MIMAT0005331 |
Previous IDs | rno-miR-708 |
Sequence |
11 - aaggagcuuacaaucuagcuggg - 33 |
Deep sequencing | 38180 reads, 428 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-708-3p |
|
Accession | MIMAT0005332 |
Previous IDs | rno-miR-708* |
Sequence |
57 - caacuagacugugagcuucuag - 78 |
Deep sequencing | 47530 reads, 413 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|