![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-188 |
||||||||||||
Accession | MI0006134 (change log) | |||||||||||
Description | Rattus norvegicus miR-188 stem-loop | |||||||||||
Gene family | MIPF0000113; mir-188 | |||||||||||
Literature search |
6 open access papers mention rno-mir-188 | |||||||||||
Stem-loop |
---c uc ca uc gu -cgag u 5' cc ucu ca ccuugcaug ggaggg c c || ||| || ||||||||| |||||| | u 3' gg agg gu gggacguac ccuccu g c gagu -u ac uu ac caaaa u |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
Mature sequence rno-miR-188-5p |
|
Accession | MIMAT0005301 |
Previous IDs | rno-miR-188 |
Sequence |
11 - caucccuugcaugguggaggg - 31 |
Deep sequencing | 19922 reads, 488 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-188-3p |
|
Accession | MIMAT0017297 |
Previous IDs | rno-miR-188* |
Sequence |
50 - cucccacaugcaggguuugc - 69 |
Deep sequencing | 273 reads, 152 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|