Stem-loop sequence rno-mir-877

AccessionMI0006119 (change log)
DescriptionRattus norvegicus miR-877 stem-loop
Gene family MIPF0000392; mir-877
Literature search

5 open access papers mention rno-mir-877
(7 sentences)

Stem-loop 
   -gua      au  c c          agguaggccuugcggg 
5'     gaggag  gg g aggggacaca                u
       ||||||  || | ||||||||||                 
3'     cuccuc  cc c ucuccugugu                c
   gacc      --  u u          acagguucccgggugu
Get sequence
Deep sequencing
10700 reads, 0.236 reads per million, 423 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr20: 3318872-3318956 [+]
sense
ENSRNOT00000001049 ; Abcf1-201; intron 13
Database links

Mature sequence rno-miR-877

Accession MIMAT0005285
Sequence

1 -  

guagaggagauggcgcaggg

 - 20

Get sequence
Deep sequencing6461 reads, 401 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).