Stem-loop sequence ppt-MIR1028c

AccessionMI0005973 (change log)
DescriptionPhyscomitrella patens miR1028c stem-loop
Literature search

1 open access papers mention ppt-MIR1028c
(1 sentences)

Stem-loop
   --cgaa  -   g  agau          a cuu                    ucuugcgaaacugacagcggaauaccggacuuuuauuugaucaugau 
5'       ga cau ga    uucauccgcg c   gcucuuagaucuacaaugcc                                               g
         || ||| ||    |||||||||| |   ||||||||||||||||||||                                                
3'       cu gua uu    aggugggcgc g   cgagaauuuggauguuacgg                                               g
   ugucca  a   g  ----          c ugu                    uguaccaccuggcguaccuaaggacuucauacuccguguacaccuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr02: 1280097-1280293 [-]
intergenic
Database links

Mature sequence ppt-miR1028c-5p

Accession MIMAT0005120
Sequence

34 - 

ucuuagaucuacaaugccucu

 - 54

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR1028c-3p

Accession MIMAT0005121
Sequence

147 - 

uggcauuguagguuuaagagc

 - 167

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).