Stem-loop sequence ppt-MIR1028b

AccessionMI0005972 (change log)
DescriptionPhyscomitrella patens miR1028b stem-loop
Literature search

1 open access papers mention ppt-MIR1028b
(1 sentences)

Stem-loop
   caaaca   --aaa     u    ga u  u      a           a   acaacagcaauacuuaagguuaugagaagauaucuaucaugcucu 
5'       agc     uccau cuug  c ag ucuuag ucuacaaugcc ccu                                             c
         |||     ||||| ||||  | || |||||| ||||||||||| |||                                             u
3'       ucg     aggug gaac  g uc agaauc agguguuacgg gga                                             g
   ---aaa   gaaua     u    ug u  c      c           c   aaguucuuuaaauuuuaaauucuaacauucuucuccuggugugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr14: 13799531-13799724 [+]
intergenic
Database links

Mature sequence ppt-miR1028b-5p

Accession MIMAT0005118
Sequence

30 - 

ucuuagaucuacaaugccacc

 - 50

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR1028b-3p

Accession MIMAT0005119
Sequence

148 - 

cggcauuguggaccuaagacc

 - 168

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).