Stem-loop sequence ppt-MIR1028a

AccessionMI0005971 (change log)
DescriptionPhyscomitrella patens miR1028a stem-loop
Literature search

1 open access papers mention ppt-MIR1028a
(1 sentences)

Stem-loop
   acccgauuuacc     au   u   a  u u                 a    cacau     g aacgaaucuggcaguaagacuucauuuauauggguccauuccgcuccaagcuuuc 
5'             uucac  cug ucc gc c uagaucuacaaugucac ugaa     acuug u                                                       a
               |||||  ||| ||| || | ||||||||||||||||| ||||     ||||| |                                                        
3'             aagug  gau agg cg g aucuagauguuacagug acuu     ugaac a                                                       c
   -uugaacuccga     gu   u   c  u c                 c    ----u     g agucaacguagugguugccagucuaaaagugauauaacgauuuagacagugucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 9417251-9417489 [-]
intergenic
Database links

Mature sequence ppt-miR1028a-5p

Accession MIMAT0005116
Sequence

30 - 

ucuuagaucuacaaugucaca

 - 50

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR1028a-3p

Accession MIMAT0005117
Sequence

193 - 

ugacauuguagaucuacgugc

 - 213

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).