Stem-loop sequence ppt-MIR1026b

AccessionMI0005968 (change log)
DescriptionPhyscomitrella patens miR1026b stem-loop
Gene family MIPF0000413; MIR1026
Literature search

2 open access papers mention ppt-MIR1026b
(4 sentences)

Stem-loop
   -------     acauaauu  ga  c  ug  c  ug         u        acuc    aacaacuguggcaauucca 
5'        cagga        ga  cu uc  aa uc  agaaagacu gagaggac    cugc                   u
          |||||        ||  || ||  || ||  ||||||||| ||||||||    ||||                   g
3'        gucuu        cu  gg ag  uu ag  ucuuucuga cucucuug    ggcg                   c
   cuacaac     --------  uc  u  gu  c  gu         u        --gc    acgucuacgacgauauuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr19: 4620195-4620346 [+]
intergenic
Database links

Mature sequence ppt-miR1026b

Accession MIMAT0005113
Sequence

30 - 

ugagaaagacuugagaggaca

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).