Stem-loop sequence ppt-MIR1026a

AccessionMI0005967 (change log)
DescriptionPhyscomitrella patens miR1026a stem-loop
Gene family MIPF0000413; MIR1026
Literature search

2 open access papers mention ppt-MIR1026a
(4 sentences)

Stem-loop
   -    aaguucuug     c   cu         a   a           ac    a   ua  c  -      ug auga     uu 
5'  auga         agaca ucu  aggucugag aag cuugagaggac  uccu caa  gc uc gggaac  c    cguuu  c
    ||||         ||||| |||  ||||||||| ||| |||||||||||  |||| |||  || || ||||||  |    |||||   
3'  uacu         uuugu agg  uucaggcuc uuc gaacuuucuug  agga guu  cg ag cccuug  g    guaga  a
   g    -auaccuug     u   -u         c   c           ac    c   ua  -  u      gu --ga     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr22: 2828956-2829126 [+]
intergenic
Database links

Mature sequence ppt-miR1026a

Accession MIMAT0005112
Sequence

30 - 

ugagaaagacuugagaggaca

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).