Stem-loop sequence ppt-MIR902l

AccessionMI0005946 (change log)
DescriptionPhyscomitrella patens miR902l stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902l
(2 sentences)

Stem-loop
   auuagcaacugcu   -          -c   c  c                 a  ug aa    gau 
5'              gca cugguuaucu  ucu gu uauguugcagauucuuc uu  c  aacu   c
                ||| ||||||||||  ||| || ||||||||||||||||| ||  |  ||||   a
3'              ugu ggcuaauagg  aga ca auacaacgucuaggaag aa  g  uuga   u
   ---cgaguaguag   a          ca   a  u                 a  gu aa    aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr26: 6398753-6398886 [+]
intergenic
Database links

Mature sequence ppt-miR902l-5p

Accession MIMAT0005087
Sequence

35 - 

uauguugcagauucuucauuu

 - 55

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902l-3p

Accession MIMAT0005088
Sequence

84 - 

agaaggaucugcaacauauac

 - 104

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).