Stem-loop sequence ppt-MIR902k

AccessionMI0005945 (change log)
DescriptionPhyscomitrella patens miR902k stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902k
(2 sentences)

Stem-loop
   guugauuuu   -gc   -          -  auuc                 a     --   u    ugaaug 
5'          gcu   aua gauuaucuuu cu    uauguugcagauucuuc uuugc  cgc cugc      a
            |||   ||| |||||||||| ||    ||||||||||||||||| |||||  ||| ||||       
3'          cgg   uau cuaauggaaa ga    auauaacgucuaggaag aaacg  gug ggcg      u
   ----auaac   uuu   g          a  ccaa                 c     aa   -    uuauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr03: 7481527-7481668 [-]
intergenic
Database links

Mature sequence ppt-miR902k-5p

Accession MIMAT0005085
Sequence

34 - 

uauguugcagauucuucauuu

 - 54

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902k-3p

Accession MIMAT0005086
Sequence

92 - 

acgaaggaucugcaauauaaa

 - 112

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).