Stem-loop sequence ppt-MIR902j

AccessionMI0005944 (change log)
DescriptionPhyscomitrella patens miR902j stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902j
(2 sentences)

Stem-loop
   gc    uaaaguu   ca   ug   -c   c  a                 a     c ag u a   --        au     u u 
5'   gggu       gaa  ggu  ccu  ucu gu uauguugcagauucuuc uuugu u  c g uca  acuauagu  ugauu g c
     ||||       |||  |||  |||  ||| || ||||||||||||||||| ||||| |  | | |||  ||||||||  ||||| | u
3'   cuca       uuu  cua  gga  aga ca auacaacgucuaggaag aaacg a  g c agu  ugauauca  acuag c a
   -a    -cauauu   ag   gu   ua   a  g                 a     u cu u -   ua        --     u g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr13: 7045952-7046124 [-]
intergenic
Database links

Mature sequence ppt-miR902j-5p

Accession MIMAT0005083
Sequence

34 - 

auauguugcagauucuucauu

 - 54

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902j-3p

Accession MIMAT0005084
Sequence

123 - 

agaaggaucugcaacauagac

 - 143

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).