Stem-loop sequence ppt-MIR902i

AccessionMI0005943 (change log)
DescriptionPhyscomitrella patens miR902i stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902i
(2 sentences)

Stem-loop
   gacaaccugcag       u     ug a                      a   g  a 
5'             aguugug ugauc  g uuaugauguagauucuucaucu uga ug a
               ||||||| |||||  | |||||||||||||||||||||| ||| || g
3'             ucagcac auuag  c aaugcuacgucuaggagguaga acu ac c
   -gcaacaagcua       u     gu a                      a   a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 5057311-5057430 [+]
intergenic
Database links

Mature sequence ppt-miR902i-5p

Accession MIMAT0005081
Sequence

30 - 

uuaugauguagauucuucau

 - 49

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902i-3p

Accession MIMAT0005082
Sequence

74 - 

uggaggaucugcaucguaaac

 - 94

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).