Stem-loop sequence ppt-MIR902h

AccessionMI0005942 (change log)
DescriptionPhyscomitrella patens miR902h stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902h
(2 sentences)

Stem-loop
   c    -acaac   caa       u g      a                  a   g      a 
5'  cugc      cca   aaucgug u aucuag uuaugauguagauucuuc ucu gaauug a
    ||||      |||   ||||||| | |||||| |||||||||||||||||| ||| |||||| u
3'  gacg      ggu   uuagcau a uagguc aauacuacaucugggaag aga uuuagc u
   -    acaaua   -ug       u g      a                  a   a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 6122671-6122798 [-]
intergenic
Database links

Mature sequence ppt-miR902h-5p

Accession MIMAT0005079
Sequence

34 - 

uuaugauguagauucuucau

 - 53

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902h-3p

Accession MIMAT0005080
Sequence

78 - 

agaagggucuacaucauaaac

 - 98

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).