Stem-loop sequence ppt-MIR902g

AccessionMI0005941 (change log)
DescriptionPhyscomitrella patens miR902g stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902g
(2 sentences)

Stem-loop
   gguagca       ---uc      -    g  a u             u    a     uua      --u     
5'        gguuugu     auuuuc uucc cu g cuaugaugcagau cuuc ucugu   gcugaa   cugc 
          |||||||     |||||| |||| || | ||||||||||||| |||| |||||   ||||||   ||| g
3'        uuagaua     uaaaag aagg ga c gauacuacgucug gaag agaca   ugacuu   gacu 
   -----ua       uuaca      u    a  a u             -    c     uug      ugu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr18: 1694902-1695042 [-]
intergenic
Database links

Mature sequence ppt-miR902g-5p

Accession MIMAT0005077
Sequence

34 - 

uaugaugcagauucuucaucu

 - 54

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902g-3p

Accession MIMAT0005078
Sequence

92 - 

acgaaggucugcaucauagu

 - 111

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).