Stem-loop sequence ppt-MIR902f

AccessionMI0005940 (change log)
DescriptionPhyscomitrella patens miR902f stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902f
(2 sentences)

Stem-loop
   gagagaaugcucuu    cu     aa a            u    aucugcgggauauuc 
5'               uugc  ucgcu  g uaugaugcagau cuuc               u
                 ||||  |||||  | |||||||||||| ||||               u
3'               aaug  ggcga  c auacuacgucua gaag               g
   -ccaucguguuaca    ag     ac a            -    cagacaauauggugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr02: 22774290-22774412 [+]
intergenic
Database links

Mature sequence ppt-miR902f-5p

Accession MIMAT0005075
Sequence

30 - 

uaugaugcagauucuucaucu

 - 50

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902f-3p

Accession MIMAT0005076
Sequence

78 - 

acgaagaucugcaucauaac

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).