Stem-loop sequence ppt-MIR902e

AccessionMI0005939 (change log)
DescriptionPhyscomitrella patens miR902e stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902e
(2 sentences)

Stem-loop
   gaca  gug  -----g  uc    c     g  a u             u    a    u       gau 
5'     gc   cc      uc  auuu cuucc cu g cuaugaugcagau cuuc ucug uucgugu   g
       ||   ||      ||  |||| ||||| || | ||||||||||||| |||| |||| |||||||   c
3'     cg   gg      ag  uaaa gaagg ga c gauacuacgucug gaag agac gagcacg   u
   ----  --a  acuuaa  ua    c     a  a u             -    c    u       ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr11: 9177888-9178020 [+]
intergenic
Database links

Mature sequence ppt-miR902e-5p

Accession MIMAT0005073
Sequence

34 - 

uaugaugcagauucuucaucu

 - 54

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902e-3p

Accession MIMAT0005074
Sequence

84 - 

acgaaggucugcaucauagu

 - 103

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).