Stem-loop sequence ppt-MIR902d

AccessionMI0005938 (change log)
DescriptionPhyscomitrella patens miR902d stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902d
(2 sentences)

Stem-loop
   aa  a   --uccc      gc  a  g               u        acuucacu  a  uu   c 
5'   gg ucc      auuugc  cc cu gguuaugaugcagau cuucaucu        gg gc  cca a
     || |||      ||||||  || || ||||||||||||||| ||||||||        || ||  |||  
3'   cc agg      uaaacg  gg ga ccgaugcuacgucug gaaguaga        cc cg  ggu a
   --  -   ucuucu      aa  a  g               -        --------  a  -u   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr01: 4328118-4328246 [-]
intergenic
Database links

Mature sequence ppt-miR902d-5p

Accession MIMAT0005071
Sequence

30 - 

uaugaugcagauucuucaucu

 - 50

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902d-3p

Accession MIMAT0005072
Sequence

84 - 

augaaggucugcaucguagc

 - 103

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).