Stem-loop sequence ppt-MIR902c

AccessionMI0005937 (change log)
DescriptionPhyscomitrella patens miR902c stem-loop
Gene family MIPF0000376; MIR902
Literature search

2 open access papers mention ppt-MIR902c
(2 sentences)

Stem-loop
   ----  uau  gc    gcuc             -a  g            u    a     uga     au 
5'     uc   ug  guau    auuuccuccuucu  gc uaugaugcagau cuuc ucugu   acuga  u
       ||   ||  ||||    |||||||||||||  || |||||||||||| |||| |||||   |||||  u
3'     ag   ac  uaua    uaaaggaggggga  ug auacuacgucug gaag agacg   ugauu  u
   ucuu  --u  ua    ----             ac  -            -    c     uag     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 13954620-13954753 [-]
intergenic
Database links

Mature sequence ppt-miR902c-5p

Accession MIMAT0005069
Sequence

35 - 

uaugaugcagauucuucaucu

 - 55

Get sequence
Evidence experimental; 454 [1]

Mature sequence ppt-miR902c-3p

Accession MIMAT0005070
Sequence

85 - 

acgaaggucugcaucauagu

 - 104

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).