Stem-loop sequence ppt-MIR537d

AccessionMI0005936 (change log)
DescriptionPhyscomitrella patens miR537d stem-loop
Gene family MIPF0000207; MIR537
Literature search

1 open access papers mention ppt-MIR537d
(1 sentences)

Stem-loop
   uugaacaau       -u    ca   a              g   c       c  u   uu     aac     uuu    aaa      ga 
5'          gucauua  caua  uag cuguagaaacaccu aag uauugau uc acu  guugu   cgauc   augg   gugcac  a
            |||||||  ||||  ||| |||||||||||||| ||| ||||||| || |||  |||||   |||||   ||||   ||||||   
3'          uaguagu  guau  auc gacaucuuugugga uuc augacua ag ugg  uagca   gcuag   uguc   uaugug  a
   --auucuau       uc    uc   g              g   a       c  -   -u     --c     ---    --g      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr07: 12177121-12177298 [+]
intergenic
Database links

Mature sequence ppt-miR537d

Accession MIMAT0005068
Sequence

136 - 

uugagguguuucuacaggcua

 - 156

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).