Stem-loop sequence ppt-MIR537c

AccessionMI0005935 (change log)
DescriptionPhyscomitrella patens miR537c stem-loop
Gene family MIPF0000207; MIR537
Literature search

1 open access papers mention ppt-MIR537c
(1 sentences)

Stem-loop
         c   a              g   u ac       a  -       ----aggua  a     a      c 
5' ucauau ugg cuguagaaacaccu aag g  ugaaguu gu ccgguuu         ug gaaug uuggag a
   |||||| ||| |||||||||||||| ||| |  ||||||| || |||||||         || ||||| |||||| c
3' aguaua auc gacaucuuugugga uuc c  acuucga cg ggccaaa         ac cuugu gaccuc c
         c   g              g   u ga       a  u       guaauguag  -     a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppt-miR537c

Accession MIMAT0005067
Sequence

122 - 

uugagguguuucuacaggcua

 - 142

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).