Stem-loop sequence ppt-MIR536f

AccessionMI0005934 (change log)
DescriptionPhyscomitrella patens miR536f stem-loop
Literature search

2 open access papers mention ppt-MIR536f
(16 sentences)

Stem-loop
   uucgacg  g    ---     u      -    ca  -                  ucucucugaacaucagauaucggucgguagaguug 
5'        uc uguu   aagug gauucc uuag  gc cauaguuugguaugaagc                                   a
          || ||||   ||||| |||||| ||||  || ||||||||||||||||||                                    
3'        ag acaa   uucac cuaagg aauc  cg gugucgaaccgugcuucg                                   g
   ----gaa  -    guc     u      g    ua  u                  cgagccuuuugucucgauuccaguacacuuguuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr12: 5496564-5496739 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR536f
ppt-MIR536fChr12: 5496564-5496739 [+]
ppt-MIR1051Chr12: 5498625-5498821 [+]
ppt-MIR536aChr12: 5501130-5501328 [-]
Database links

Mature sequence ppt-miR536f

Accession MIMAT0005066
Sequence

127 - 

uucgugccaagcugugugca

 - 146

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).