Stem-loop sequence ppt-MIR536e

AccessionMI0005933 (change log)
DescriptionPhyscomitrella patens miR536e stem-loop
Gene family MIPF0000398; MIR536
Literature search

2 open access papers mention ppt-MIR536e
(16 sentences)

Stem-loop
   -------------------------------------------------------------------------------------------------uguguggauccuaagugucuccccuuggaagccgcaguuuggcaugaagcacuuauuccuuugcgcauccauuuugugacugcuuguauugagucgaauccaauuccuugccuucuacuucc   c  uc    ucac   ---u -        c    -----    -  u uu      c    u 
5'                                                                                                                                                                                                                            uuc aa  uaga    ucc    g guuuuuca auug     uuug gu g  gggggu auau g
                                                                                                                                                                                                                              ||| ||  ||||    |||    | |||||||| ||||     |||| || |  |||||| |||| u
3'                                                                                                                                                                                                                            aag uu  aucu    agg    c cagaaagu uaac     aagc cg u  uuucca uaug u
   gaaccaacgugugucgaaccgugcuuugagacuauaggggaguuauuaaaaucccucuuuagcacguaccuguugacuucuaacugcucauaucacucuaauugucacgaucauacaagcaggggccaucacugacgucacugaaagacgucagugacuucauccgcgcguuuccuucuauggcuguucuggaguuugauaacccacaccgacgucuuu   c  ua    -caa   uugu g        u    uucua    a  c uu      -    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr23: 1247525-1247988 [+]
intergenic
Database links

Mature sequence ppt-miR536e

Accession MIMAT0005065
Sequence

439 - 

uucgugccaagcugugugcaac

 - 460

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).