Stem-loop sequence ppt-MIR536d

AccessionMI0005932 (change log)
DescriptionPhyscomitrella patens miR536d stem-loop
Gene family MIPF0000398; MIR536
Literature search

2 open access papers mention ppt-MIR536d
(16 sentences)

Stem-loop
   agggugcauuccaagugccg        aa  -                 cc  uu -  cugccgcuacuguuuuguuagucagguuugcagcgugucucgauauaguggugugcuuccguugcuauccuuucccuccagguaggaauucuguggcaaacuagugguugguucgcuuaucaaguugcaguccuucauaccuugauuuugaauuacugcagu 
5'                     ucccuugg  gc cgcaguuuggcacgaag  cu  c uc                                                                                                                                                                  c
                       ||||||||  || |||||||||||||||||  ||  | ||                                                                                                                                                                   
3'                     ggggaacc  cg gugucgaaccgugcuuu  ga  g ag                                                                                                                                                                  a
   -caccuaaacuucauuguuu        aa  u                 aa  uu u  aaaggcgauguucacccaccucacccaaguuguaguugggucuucaucuucgaucguuuugauacuccuuuuacguugcuguggagguaacgaagcugaaagacgucagucacgucagccauccuguguguuuuuuuuuuuuuugacggcuguucuucccac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr24: 5312887-5313329 [+]
intergenic
Database links

Mature sequence ppt-miR536d

Accession MIMAT0005064
Sequence

396 - 

uucgugccaagcugugugcaac

 - 417

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).