Stem-loop sequence ppt-MIR477h

AccessionMI0005920 (change log)
DescriptionPhyscomitrella patens miR477h stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477h
(11 sentences)

Stem-loop
   ucagagggaguauacucagguguu   uuu      u a     u      u   ucagcauucuauuccacuucug 
5'                         ugu   ucuccc c aaggc uccaac aca                      g
                           |||   |||||| | ||||| |||||| |||                       
3'                         aca   agaggg g uuccg agguug ugu                      c
   -cguuguguaguuacuguccccau   ugu      u a     u      u   ugcguuuaagugacguagaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 3739666-3739820 [+]
intergenic
Database links

Mature sequence ppt-miR477h

Accession MIMAT0005053
Sequence

31 - 

ucucccucaaaggcuucca

 - 49

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).