Stem-loop sequence ppt-MIR477e

AccessionMI0005919 (change log)
DescriptionPhyscomitrella patens miR477e stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477e
(11 sentences)

Stem-loop
   gaugagaagauuccga      g   c  au         u          caa  uc    gu 
5'                 aaggcg uug uu  cucucuccc caaaggcuuc   ca  aggu  a
                   |||||| ||| ||  ||||||||| ||||||||||   ||  ||||   
3'                 uuccgc aac aa  gggagaggg guuuccgaag   gu  uccg  g
   -cuugccguuauuacg      a   a  gg         u          auc  --    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr06: 11394397-11394523 [-]
intergenic
Database links

Mature sequence ppt-miR477e

Accession MIMAT0005052
Sequence

34 - 

cucucccucaaaggcuucca

 - 53

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).