Stem-loop sequence ppt-MIR477d

AccessionMI0005918 (change log)
DescriptionPhyscomitrella patens miR477d stem-loop
Gene family MIPF0000216; MIR477
Literature search

1 open access papers mention ppt-MIR477d
(11 sentences)

Stem-loop
   guugauuucgauuaa    a     ug   c  u      a       c    ------  a   a     uc     uu 
5'                acag uugcu  uuc uc cccuca aggcuuc aaca      ac ggu cuugg  uuguu  c
                  |||| |||||  ||| || |||||| ||||||| ||||      || ||| |||||  |||||   
3'                uguc gacga  aag ag gggggu uccgaag uugu      ug ccg gaauc  aacga  a
   uacccuuggugggua    -     cg   c  u      c       a    agaccc  c   -     ga     cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr02: 13760290-13760443 [+]
intergenic
Database links

Mature sequence ppt-miR477d

Accession MIMAT0005051
Sequence

31 - 

cucucccucaaaggcuucca

 - 50

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).