Stem-loop sequence ppt-MIR408b

AccessionMI0005917 (change log)
DescriptionPhyscomitrella patens miR408b stem-loop
Gene family MIPF0000102; MIR408
Literature search

1 open access papers mention ppt-MIR408b
(4 sentences)

Stem-loop
   gugga    --a          - aagg -           c -u      a       ca       g c    a 
5'      agag   gagaguggug g    g agggaagccag g  gaggca ugcauga  acagcau c cagg g
        ||||   |||||||||| |    | ||||||||||| |  |||||| |||||||  ||||||| | ||||  
3'      ucuc   uucuuaccgc c    c ucccuucgguc c  cuccgu acguacu  uguugug g gucc g
   -----    gug          u gaua a           c uu      c       cc       g a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr17: 9264176-9264319 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR408b
ppt-MIR408bChr17: 9264176-9264319 [+]
ppt-MIR1073Chr17: 9265541-9265741 [+]
Database links

Mature sequence ppt-miR408b

Accession MIMAT0005050
Sequence

94 - 

ugcacugccucuucccuggcu

 - 114

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).