Stem-loop sequence ppt-MIR166m

AccessionMI0005916 (change log)
DescriptionPhyscomitrella patens miR166m stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166m
(5 sentences)

Stem-loop
   g  ga  acaga  u         c  c  u        ug  a   cu   u    --     g 
5'  cc  ga     ga uguguagcu ag ug aaggaaug  gc ugg  cga gcug  uuuga c
    ||  ||     || ||||||||| || || ||||||||  || |||  ||| ||||  ||||| a
3'  gg  cu     uu acacauuga uc ac uuccuuac  cg acc  gcu cgac  gaacu u
   a  ac  -acag  u         c  u  u        ua  g   ag   c    uu     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr27: 681930-682059 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166m
ppt-MIR166kChr27: 682470-682592 [-]
ppt-MIR166hChr27: 682285-682410 [-]
ppt-MIR166mChr27: 681930-682059 [-]
Database links

Mature sequence ppt-miR166m

Accession MIMAT0005049
Sequence

80 - 

ucggaccaggcaucauuccuu

 - 100

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).