Stem-loop sequence ppt-MIR166l

AccessionMI0005915 (change log)
DescriptionPhyscomitrella patens miR166l stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166l
(5 sentences)

Stem-loop
   aauuugugaa   -ga   a      u   u         c  g   c   u   c   ua   u  c 
5'           gcu   aug aacguu ucg ggggaauga gu ugg ccg agc aug  ucu gg a
             |||   ||| |||||| ||| ||||||||| || ||| ||| ||| |||  ||| ||  
3'           ugg   uac uugcaa ggc ccccuuacu cg acc ggc ucg uau  aga cc u
   --uguauuaa   uag   g      c   u         u  g   a   c   -   ua   -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr05: 7144693-7144825 [+]
intergenic
Database links

Mature sequence ppt-miR166l

Accession MIMAT0005048
Sequence

83 - 

uccggaccaggcuucauuccc

 - 103

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).