Stem-loop sequence ppt-MIR166k

AccessionMI0005914 (change log)
DescriptionPhyscomitrella patens miR166k stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166k
(5 sentences)

Stem-loop
   gaaga  -   g  g   --        u a       c  a   c   a    a  -  uu  a 
5'      ug cug au ugc  cuuugccg g ggaauga gu ugg ccg agcu uc uc  gg u
        || ||| || |||  |||||||| | ||||||| || ||| ||| |||| || ||  ||  
3'      ac ggu ua acg  gaggcggc c ccuuacu cg acc ggc ucga ag ag  cc g
   ----c  a   g  a   uu        u c       u  g   a   c    -  u  uu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr27: 682470-682592 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166k
ppt-MIR166kChr27: 682470-682592 [-]
ppt-MIR166hChr27: 682285-682410 [-]
ppt-MIR166mChr27: 681930-682059 [-]
Database links

Mature sequence ppt-miR166k

Accession MIMAT0005047
Sequence

77 - 

uccggaccaggcuucauuccc

 - 97

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).