Stem-loop sequence ppt-MIR166j

AccessionMI0005913 (change log)
DescriptionPhyscomitrella patens miR166j stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166j
(5 sentences)

Stem-loop
   gaagauguuauauaua  ug  a      u a       c  g   c   a   ca    uu  g 
5'                 ug  ac uugccg g ggaauga gu ugg ccg agc  uauc  gg u
                   ||  || |||||| | ||||||| || ||| ||| |||  ||||  ||  
3'                 ac  ug gacggc c ccuuacu cg acc ggc ucg  guag  cc u
   -gggaaagggugaaca  gu  a      u c       u  g   a   c   aa    uu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr16: 2418918-2419048 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166j
ppt-MIR166iChr16: 2418753-2418872 [+]
ppt-MIR166jChr16: 2418918-2419048 [+]
Database links

Mature sequence ppt-miR166j

Accession MIMAT0005046
Sequence

81 - 

uccggaccaggcuucauuccc

 - 101

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).