Stem-loop sequence ppt-MIR166i

AccessionMI0005912 (change log)
DescriptionPhyscomitrella patens miR166i stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166i
(5 sentences)

Stem-loop
   cuuggagauug    g     u u  u     u   c  a   ca      u   --   c 
5'            gaug gacuu g cg gggga uga gc ugg  cgaagc aac  auc u
              |||| ||||| | || ||||| ||| || |||  |||||| |||  |||  
3'            cuac uugaa c gu ccccu acu cg acc  gcuucg uug  uag g
   -ucgugaugua    g     u c  u     u   u  g   ag      -   ac   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr16: 2418753-2418872 [+]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166i
ppt-MIR166iChr16: 2418753-2418872 [+]
ppt-MIR166jChr16: 2418918-2419048 [+]
Database links

Mature sequence ppt-miR166i

Accession MIMAT0005045
Sequence

74 - 

ucggaccaggcuucauucccc

 - 94

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).