Stem-loop sequence ppt-MIR166h

AccessionMI0005911 (change log)
DescriptionPhyscomitrella patens miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ppt-MIR166h
(5 sentences)

Stem-loop
   aguuc    ag   ---   ag   u     u a       c ag   -  c       -        
5'      gaca  acu   aug  acu uguca g ggaauga g  ugg cc agauucg uuucugg 
        ||||  |||   |||  ||| ||||| | ||||||| |  ||| || ||||||| |||||| u
3'      cugu  ugg   uac  ugg acggu c ccuuacu c  acc gg uuuaagu aaagauc 
   ----a    ca   agg   cu   c     u c       u gg   a  c       u        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr27: 682285-682410 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR166h
ppt-MIR166kChr27: 682470-682592 [-]
ppt-MIR166hChr27: 682285-682410 [-]
ppt-MIR166mChr27: 681930-682059 [-]
Database links

Mature sequence ppt-miR166h

Accession MIMAT0005044
Sequence

78 - 

ucggaccaggcuucauucccc

 - 98

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).